Review



plko rictor shrna 2 addgene sarbassov  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Addgene inc plko rictor shrna 2 addgene sarbassov
    Plko Rictor Shrna 2 Addgene Sarbassov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rictor+2+shrna+addgene/ATF4+7%3A+5%E2%80%993%E2%80%99ATF4%2EGFP+(Plasmid+%2321854)/pm37405918-135-86-89
    Average 92 stars, based on 2 article reviews
    plko rictor shrna 2 addgene sarbassov - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Mitochondrial-encoded MOTS-c prevents pancreatic islet destruction in autoimmune diabetes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Convenient System for Reverse Transcription Using AMV Reverse Transcriptase Promega Cat#A3500 Performa Nano test strip Accucheck Cat#06454011 Dynabead Co-immunoprecipitation kit Thermo Cat#14321D Deposited data NOD spleen microarray This paper GEO: GSE168324 Raptor structure Yang et al., 2017 PDB: 5WBI Raptor-TOS motifs of 4EBP-1 structure Yang et al., 2017 PDB: 5WBJ Raptor-TOS motifs of S6K structure Yang et al., 2017 PDB:5WBK MOTS-c structure This paper Pepfold 3.0, https://mobyle.rpbs. univ-paris-diderot.fr/cgi-bin/portal. py#forms::PEP-FOLD3 Experimental models: Cell lines Jurkat American Type Culture Collection TIB-152 HEK293 FT Thermo R70007 Oligonucleotides mouse Tgfb1, 119 bp Bioneer PM00298 mouse Il4, 146 bp Bioneer PM00427 mouse Il17a, 163 bp Bioneer PM00227 mouse Il10ra, 114 bp Bioneer PM00448 mouse Prdm1, 132 bp Bioneer PM00449 mouse MAf, 90 bp, Bioneer PM00450 mouse Ahr, 159 bp Bioneer PM00451 mouse Gzmb, 115 bp Bioneer PM00452 mouse Ctla4, 83 bp Bioneer PM00453 mouse Hprt, 160 bp Bioneer PM00454 mouse CD49b (Itga2) Bioneer PM00235 mouse Foxp3 Bioneer PM00075 mouse IL-10 Bioneer PM00118 mouse Lag3 Bioneer PM00179 Please Refer to Table S1 for oligonucleotide information N/A N/A Recombinant DNA pcDNA3.1 Thermo Fisher Scientific Cat# V79520 pLJM1-EGFP Addgene Cat#19319 MOTS-c WT Lee et al., 2015 N/A MOTS-c Mut Kim et al., 2018 N/A myc-Rptor Addgene Cat#1859 myc-Rictor Addgene Cat#11367 Rictor 1 shRNA Addgene Cat#1853 Rictor 2 shRNA Addgene Cat#1854 Rptor 1 shRNA Addgene Cat#1855 Rptor 2 shRNA Addgene Cat#1856 mTOR1 shRNA Addgene Cat#1857 mTOR2 shRNA Addgene Cat#1858 Software and algorithms Pymol 2.3 Pymol https://www.pymol.org PyRX 2.0 PyRx N/A (Continued on next page) Cell Reports 36, 109447, July 27, 2021 e3

    Stripping Membranes:

    Article Title: Mitochondrial-encoded MOTS-c prevents pancreatic islet destruction in autoimmune diabetes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Convenient System for Reverse Transcription Using AMV Reverse Transcriptase Promega Cat#A3500 Performa Nano test strip Accucheck Cat#06454011 Dynabead Co-immunoprecipitation kit Thermo Cat#14321D Deposited data NOD spleen microarray This paper GEO: GSE168324 Raptor structure Yang et al., 2017 PDB: 5WBI Raptor-TOS motifs of 4EBP-1 structure Yang et al., 2017 PDB: 5WBJ Raptor-TOS motifs of S6K structure Yang et al., 2017 PDB:5WBK MOTS-c structure This paper Pepfold 3.0, https://mobyle.rpbs. univ-paris-diderot.fr/cgi-bin/portal. py#forms::PEP-FOLD3 Experimental models: Cell lines Jurkat American Type Culture Collection TIB-152 HEK293 FT Thermo R70007 Oligonucleotides mouse Tgfb1, 119 bp Bioneer PM00298 mouse Il4, 146 bp Bioneer PM00427 mouse Il17a, 163 bp Bioneer PM00227 mouse Il10ra, 114 bp Bioneer PM00448 mouse Prdm1, 132 bp Bioneer PM00449 mouse MAf, 90 bp, Bioneer PM00450 mouse Ahr, 159 bp Bioneer PM00451 mouse Gzmb, 115 bp Bioneer PM00452 mouse Ctla4, 83 bp Bioneer PM00453 mouse Hprt, 160 bp Bioneer PM00454 mouse CD49b (Itga2) Bioneer PM00235 mouse Foxp3 Bioneer PM00075 mouse IL-10 Bioneer PM00118 mouse Lag3 Bioneer PM00179 Please Refer to Table S1 for oligonucleotide information N/A N/A Recombinant DNA pcDNA3.1 Thermo Fisher Scientific Cat# V79520 pLJM1-EGFP Addgene Cat#19319 MOTS-c WT Lee et al., 2015 N/A MOTS-c Mut Kim et al., 2018 N/A myc-Rptor Addgene Cat#1859 myc-Rictor Addgene Cat#11367 Rictor 1 shRNA Addgene Cat#1853 Rictor 2 shRNA Addgene Cat#1854 Rptor 1 shRNA Addgene Cat#1855 Rptor 2 shRNA Addgene Cat#1856 mTOR1 shRNA Addgene Cat#1857 mTOR2 shRNA Addgene Cat#1858 Software and algorithms Pymol 2.3 Pymol https://www.pymol.org PyRX 2.0 PyRx N/A (Continued on next page) Cell Reports 36, 109447, July 27, 2021 e3

    Microarray:

    Article Title: Mitochondrial-encoded MOTS-c prevents pancreatic islet destruction in autoimmune diabetes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Convenient System for Reverse Transcription Using AMV Reverse Transcriptase Promega Cat#A3500 Performa Nano test strip Accucheck Cat#06454011 Dynabead Co-immunoprecipitation kit Thermo Cat#14321D Deposited data NOD spleen microarray This paper GEO: GSE168324 Raptor structure Yang et al., 2017 PDB: 5WBI Raptor-TOS motifs of 4EBP-1 structure Yang et al., 2017 PDB: 5WBJ Raptor-TOS motifs of S6K structure Yang et al., 2017 PDB:5WBK MOTS-c structure This paper Pepfold 3.0, https://mobyle.rpbs. univ-paris-diderot.fr/cgi-bin/portal. py#forms::PEP-FOLD3 Experimental models: Cell lines Jurkat American Type Culture Collection TIB-152 HEK293 FT Thermo R70007 Oligonucleotides mouse Tgfb1, 119 bp Bioneer PM00298 mouse Il4, 146 bp Bioneer PM00427 mouse Il17a, 163 bp Bioneer PM00227 mouse Il10ra, 114 bp Bioneer PM00448 mouse Prdm1, 132 bp Bioneer PM00449 mouse MAf, 90 bp, Bioneer PM00450 mouse Ahr, 159 bp Bioneer PM00451 mouse Gzmb, 115 bp Bioneer PM00452 mouse Ctla4, 83 bp Bioneer PM00453 mouse Hprt, 160 bp Bioneer PM00454 mouse CD49b (Itga2) Bioneer PM00235 mouse Foxp3 Bioneer PM00075 mouse IL-10 Bioneer PM00118 mouse Lag3 Bioneer PM00179 Please Refer to Table S1 for oligonucleotide information N/A N/A Recombinant DNA pcDNA3.1 Thermo Fisher Scientific Cat# V79520 pLJM1-EGFP Addgene Cat#19319 MOTS-c WT Lee et al., 2015 N/A MOTS-c Mut Kim et al., 2018 N/A myc-Rptor Addgene Cat#1859 myc-Rictor Addgene Cat#11367 Rictor 1 shRNA Addgene Cat#1853 Rictor 2 shRNA Addgene Cat#1854 Rptor 1 shRNA Addgene Cat#1855 Rptor 2 shRNA Addgene Cat#1856 mTOR1 shRNA Addgene Cat#1857 mTOR2 shRNA Addgene Cat#1858 Software and algorithms Pymol 2.3 Pymol https://www.pymol.org PyRX 2.0 PyRx N/A (Continued on next page) Cell Reports 36, 109447, July 27, 2021 e3

    Recombinant:

    Article Title: Mitochondrial-encoded MOTS-c prevents pancreatic islet destruction in autoimmune diabetes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Convenient System for Reverse Transcription Using AMV Reverse Transcriptase Promega Cat#A3500 Performa Nano test strip Accucheck Cat#06454011 Dynabead Co-immunoprecipitation kit Thermo Cat#14321D Deposited data NOD spleen microarray This paper GEO: GSE168324 Raptor structure Yang et al., 2017 PDB: 5WBI Raptor-TOS motifs of 4EBP-1 structure Yang et al., 2017 PDB: 5WBJ Raptor-TOS motifs of S6K structure Yang et al., 2017 PDB:5WBK MOTS-c structure This paper Pepfold 3.0, https://mobyle.rpbs. univ-paris-diderot.fr/cgi-bin/portal. py#forms::PEP-FOLD3 Experimental models: Cell lines Jurkat American Type Culture Collection TIB-152 HEK293 FT Thermo R70007 Oligonucleotides mouse Tgfb1, 119 bp Bioneer PM00298 mouse Il4, 146 bp Bioneer PM00427 mouse Il17a, 163 bp Bioneer PM00227 mouse Il10ra, 114 bp Bioneer PM00448 mouse Prdm1, 132 bp Bioneer PM00449 mouse MAf, 90 bp, Bioneer PM00450 mouse Ahr, 159 bp Bioneer PM00451 mouse Gzmb, 115 bp Bioneer PM00452 mouse Ctla4, 83 bp Bioneer PM00453 mouse Hprt, 160 bp Bioneer PM00454 mouse CD49b (Itga2) Bioneer PM00235 mouse Foxp3 Bioneer PM00075 mouse IL-10 Bioneer PM00118 mouse Lag3 Bioneer PM00179 Please Refer to Table S1 for oligonucleotide information N/A N/A Recombinant DNA pcDNA3.1 Thermo Fisher Scientific Cat# V79520 pLJM1-EGFP Addgene Cat#19319 MOTS-c WT Lee et al., 2015 N/A MOTS-c Mut Kim et al., 2018 N/A myc-Rptor Addgene Cat#1859 myc-Rictor Addgene Cat#11367 Rictor 1 shRNA Addgene Cat#1853 Rictor 2 shRNA Addgene Cat#1854 Rptor 1 shRNA Addgene Cat#1855 Rptor 2 shRNA Addgene Cat#1856 mTOR1 shRNA Addgene Cat#1857 mTOR2 shRNA Addgene Cat#1858 Software and algorithms Pymol 2.3 Pymol https://www.pymol.org PyRX 2.0 PyRx N/A (Continued on next page) Cell Reports 36, 109447, July 27, 2021 e3

    shRNA:

    Article Title: Mitochondrial-encoded MOTS-c prevents pancreatic islet destruction in autoimmune diabetes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Convenient System for Reverse Transcription Using AMV Reverse Transcriptase Promega Cat#A3500 Performa Nano test strip Accucheck Cat#06454011 Dynabead Co-immunoprecipitation kit Thermo Cat#14321D Deposited data NOD spleen microarray This paper GEO: GSE168324 Raptor structure Yang et al., 2017 PDB: 5WBI Raptor-TOS motifs of 4EBP-1 structure Yang et al., 2017 PDB: 5WBJ Raptor-TOS motifs of S6K structure Yang et al., 2017 PDB:5WBK MOTS-c structure This paper Pepfold 3.0, https://mobyle.rpbs. univ-paris-diderot.fr/cgi-bin/portal. py#forms::PEP-FOLD3 Experimental models: Cell lines Jurkat American Type Culture Collection TIB-152 HEK293 FT Thermo R70007 Oligonucleotides mouse Tgfb1, 119 bp Bioneer PM00298 mouse Il4, 146 bp Bioneer PM00427 mouse Il17a, 163 bp Bioneer PM00227 mouse Il10ra, 114 bp Bioneer PM00448 mouse Prdm1, 132 bp Bioneer PM00449 mouse MAf, 90 bp, Bioneer PM00450 mouse Ahr, 159 bp Bioneer PM00451 mouse Gzmb, 115 bp Bioneer PM00452 mouse Ctla4, 83 bp Bioneer PM00453 mouse Hprt, 160 bp Bioneer PM00454 mouse CD49b (Itga2) Bioneer PM00235 mouse Foxp3 Bioneer PM00075 mouse IL-10 Bioneer PM00118 mouse Lag3 Bioneer PM00179 Please Refer to Table S1 for oligonucleotide information N/A N/A Recombinant DNA pcDNA3.1 Thermo Fisher Scientific Cat# V79520 pLJM1-EGFP Addgene Cat#19319 MOTS-c WT Lee et al., 2015 N/A MOTS-c Mut Kim et al., 2018 N/A myc-Rptor Addgene Cat#1859 myc-Rictor Addgene Cat#11367 Rictor 1 shRNA Addgene Cat#1853 Rictor 2 shRNA Addgene Cat#1854 Rptor 1 shRNA Addgene Cat#1855 Rptor 2 shRNA Addgene Cat#1856 mTOR1 shRNA Addgene Cat#1857 mTOR2 shRNA Addgene Cat#1858 Software and algorithms Pymol 2.3 Pymol https://www.pymol.org PyRX 2.0 PyRx N/A (Continued on next page) Cell Reports 36, 109447, July 27, 2021 e3

    Software:

    Article Title: Mitochondrial-encoded MOTS-c prevents pancreatic islet destruction in autoimmune diabetes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Convenient System for Reverse Transcription Using AMV Reverse Transcriptase Promega Cat#A3500 Performa Nano test strip Accucheck Cat#06454011 Dynabead Co-immunoprecipitation kit Thermo Cat#14321D Deposited data NOD spleen microarray This paper GEO: GSE168324 Raptor structure Yang et al., 2017 PDB: 5WBI Raptor-TOS motifs of 4EBP-1 structure Yang et al., 2017 PDB: 5WBJ Raptor-TOS motifs of S6K structure Yang et al., 2017 PDB:5WBK MOTS-c structure This paper Pepfold 3.0, https://mobyle.rpbs. univ-paris-diderot.fr/cgi-bin/portal. py#forms::PEP-FOLD3 Experimental models: Cell lines Jurkat American Type Culture Collection TIB-152 HEK293 FT Thermo R70007 Oligonucleotides mouse Tgfb1, 119 bp Bioneer PM00298 mouse Il4, 146 bp Bioneer PM00427 mouse Il17a, 163 bp Bioneer PM00227 mouse Il10ra, 114 bp Bioneer PM00448 mouse Prdm1, 132 bp Bioneer PM00449 mouse MAf, 90 bp, Bioneer PM00450 mouse Ahr, 159 bp Bioneer PM00451 mouse Gzmb, 115 bp Bioneer PM00452 mouse Ctla4, 83 bp Bioneer PM00453 mouse Hprt, 160 bp Bioneer PM00454 mouse CD49b (Itga2) Bioneer PM00235 mouse Foxp3 Bioneer PM00075 mouse IL-10 Bioneer PM00118 mouse Lag3 Bioneer PM00179 Please Refer to Table S1 for oligonucleotide information N/A N/A Recombinant DNA pcDNA3.1 Thermo Fisher Scientific Cat# V79520 pLJM1-EGFP Addgene Cat#19319 MOTS-c WT Lee et al., 2015 N/A MOTS-c Mut Kim et al., 2018 N/A myc-Rptor Addgene Cat#1859 myc-Rictor Addgene Cat#11367 Rictor 1 shRNA Addgene Cat#1853 Rictor 2 shRNA Addgene Cat#1854 Rptor 1 shRNA Addgene Cat#1855 Rptor 2 shRNA Addgene Cat#1856 mTOR1 shRNA Addgene Cat#1857 mTOR2 shRNA Addgene Cat#1858 Software and algorithms Pymol 2.3 Pymol https://www.pymol.org PyRX 2.0 PyRx N/A (Continued on next page) Cell Reports 36, 109447, July 27, 2021 e3



    Similar Products

    92
    Addgene inc plko rictor shrna 2 addgene sarbassov
    Plko Rictor Shrna 2 Addgene Sarbassov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rictor+2+shrna+addgene/ATF4+7%3A+5%E2%80%993%E2%80%99ATF4%2EGFP+(Plasmid+%2321854)/pm37405918-135-86-89
    Average 92 stars, based on 1 article reviews
    plko rictor shrna 2 addgene sarbassov - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    93
    Addgene inc rictor 2 shrna addgene
    Rictor 2 Shrna Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rictor+2+shrna+addgene/Rictor_2+shRNA+(Plasmid+%231854)/pm34320351-241-212-215
    Average 93 stars, based on 1 article reviews
    rictor 2 shrna addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc cagccttgaactgtttaactt human raptor 1 addgene
    Cagccttgaactgtttaactt Human Raptor 1 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rictor+2+shrna+addgene/Rictor_2+shRNA+(Plasmid+%231854)/pmc06717289__pnas__1901765116__sapp-192-155-159
    Average 93 stars, based on 1 article reviews
    cagccttgaactgtttaactt human raptor 1 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ttcagcgtccctaccttcttct mouse rictor 1 addgene
    Ttcagcgtccctaccttcttct Mouse Rictor 1 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rictor+2+shrna+addgene/mTOR_2+shRNA+(Plasmid+%231856)/pmc06717289__pnas__1901765116__sapp-192-181-185
    Average 93 stars, based on 1 article reviews
    ttcagcgtccctaccttcttct mouse rictor 1 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc tacttgtgaagaatcgtatctt human rictor 2 addgene
    Tacttgtgaagaatcgtatctt Human Rictor 2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rictor+2+shrna+addgene/Rictor_1+shRNA+(Plasmid+%231853)/pmc06717289__pnas__1901765116__sapp-192-149-153
    Average 93 stars, based on 1 article reviews
    tacttgtgaagaatcgtatctt human rictor 2 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results